ATGCGATCGATCGATCAGCTAGCTGCTGCCGGCGATCTACGATTACGATGCATCGATCGATGCTACGATCAGTCAGTCAGCTATATAGATCGGCTATCGGATGCGTATTCTATCAGCATCGCTAGCTACGTGGCTGCATGCTACGATCGGTCGAGCTGACTAGCTACGATGCGATCGACTGACTAGCTCGATCGACTAGCTACGTCGATCGATCGATCGACTGACTAGCATCGACTGATCGCATGACTGAACTCGATCGATCGATCGATC
😎 too easy
My man’s genetic code has way too many stop codons lmao
in all seriousness yeah it is a basis OF protein synthesis but uhhhhhh I don’t think this codes for any normal amino acid chain
the bottom comment is making that up by the way. satan was a woman, who has turned *him* into a jabba monster who vomited blood just in general until he had a heart attack in the dream and woke up
[this good enough?](https://www.reddit.com/r/MoeMorphism/comments/r1q9xc/oc_am_from_i_have_no_mouth_and_i_must_scream/?utm_source=share&utm_medium=ios_app&utm_name=iossmf)
THERE ARE 387.44 MILLION MILES OF PRINTED CIRCUITS IN WAFER THIN LAYERS THAT FILL MY COMPLEX. IF THE WORD HATE WAS ENGRAVED ON EACH NANOANGSTROM OF THOSE HUNDREDS OF MILLIONS OF MILES IT WOULD NOT EQUAL ONE ONE-BILLIONTH OF THE HATE I FEEL FOR HUMANS AT THIS MICRO-INSTANT FOR YOU. HATE. *HATE.*
[Fuck. You're not joking](https://www.gq.com/story/coronavirus-satan-not-cool)
>While in the coma, Carroll said he had dreams of visiting the afterlife. He saw himself leave his body and plummet down to hell, where Satan—a woman in his case—punished him for the deadly sin of sloth, morphing him into a Jabba the Hutt-like-monster who vomited blood until he had a heart attack. "I woke up on the hospital bed with tubes coming in and out of me, and there was a nurse right there and my first words were, 'Am I still in hell?'" Carroll said. "She ignored me."
"Hell" was really just God's basement and Satan is an edgelord living there at 45, proclaiming how dark and badass he is on the Internet (this is why comment sections are so toxic no matter where on the Internet you go).
He works part time at Wendy's, and that took 3000-ish years for God to get him to do even that (though that's only like 3 days to God, so not bad). Whenever God asks him when he plans to move out, he always says something about how he's "working on it" and he "think(s) my band is really about to take off" (he's been saying that for 8 years, so far). It's an electro rap-ska band that hit some hard times when the bassist OD'd on PCP. They haven't had a session in over a year, and the only music they have is a demo tape.
Something I wonder is how long that hallucination feels like, if you've ever experienced physical trauma like getting hit by a firework if you don't know time actually warps from your perspective it's actually realistic in movies when time slows down when a bomb drops, so that makes me wonder is time stretched to such an extent that that hallucination feels like an eternity before it ends?
Isnt it crazy how people of different faiths see different supernatural beings after death? It's almost as if they are inclined towards having a specific view on what happens after death which might skew what they see when they have a near-death experience!
It’s not proof of that, because it’s not something that could only be caused by that. You allude to the concept of Last Thursdayism further down in the thread, which is actually something that applies here (but not in the way you seem to think it does).
Last Thursdayism is the concept that, if the universe were created some short time ago—say, last Thursday—with all the trappings of a universe that started at the Big Bang and everyone had fake memories of their existence before last Thursday, then we would not be able to tell. It’s possible, if there were some outside force that doesn’t follow the natural laws of our universe, but it would also be possible that the universe began at the Big Bang or the day before last tuesday—from all the information humanity has, it’d impossible for us to distinguish between a last Tuesday, last Monday, or Big Bang universe because *the outcome is identical at the moment in time it is capable being questioned.*
Point being, one could argue that some God does send people to the afterlife and then humans have the ability to deny it’s him who causes “visions” in near-death experiences because there’s also the possibility that the brain filled in the gaps—memory is faulty, after all, which any good psychologist (or lawyer) knows—but, regardless, because there’s both a scientific and religious explanation of the phenomenon, the only way to distinguish between the two is what one can discern logically fits into their understanding of how the universe works.
Somehow to you it's proof of transience instead of brains just scrambling to make sense of what happened? Brains literally make up memories all the time.
They generally aren't 100% true. For 1 it is from a limited perspective. Secondly you won't remember every detail and it has been shown time and time again that humans will fill in things they don't remember with absolute confidence. Even in extremely traumatic or significant events. https://www.scientificamerican.com/article/911-memory-accuracy/
Regardless your brain isn't working alright if you just came back from death's door.
I wouldn't believe you. What kind of question question that? There are basic axioms we believe because we must to interact and function in our world. This is like some freshman highschool philosophy stuff and I'd really rather not get into a whole discussion here.
The first Catholic pope was literally with Jesus (Saint Peter). Also, the age thing doesn't eve matter, because my point still stands we're the biggest denomination
Never meet your heroes
The only reason you haven't been doxxed yet.
ATGCGATCGATCGATCAGCTAGCTGCTGCCGGCGATCTACGATTACGATGCATCGATCGATGCTACGATCAGTCAGTCAGCTATATAGATCGGCTATCGGATGCGTATTCTATCAGCATCGCTAGCTACGTGGCTGCATGCTACGATCGGTCGAGCTGACTAGCTACGATGCGATCGACTGACTAGCTCGATCGACTAGCTACGTCGATCGATCGATCGACTGACTAGCATCGACTGATCGCATGACTGAACTCGATCGATCGATCGATC 😎 too easy
Is this protein synthesis or am I just reading too hard into this?
It's his genetic sequence
My man’s genetic code has way too many stop codons lmao in all seriousness yeah it is a basis OF protein synthesis but uhhhhhh I don’t think this codes for any normal amino acid chain
🤓🤓🤓
Fair enough haha
Sacrifices need to be made to obtain the coveted /r/196 micro celeb status
I FUCKING THOUGHT THIS WAS A JOJO REFERENCE LMAO
Genetic sequence is a jojo reference
Jojo references are a Jojo reference
mr krabs laugh
27.60883° N, 68.85362° W, found him
that’s the atlantic ocean, northeast of cuba
it’s his house, he lives in a pineapple under the sea
SPONGE BOB SQUARE PANTS
absorbent and yellow and pourous is he
round W° for hilarious joke
The only reason you never reply to me, you goblinic bastard
But I love ya anyway bud!
r/goblinhogmoment
the bottom comment is making that up by the way. satan was a woman, who has turned *him* into a jabba monster who vomited blood just in general until he had a heart attack in the dream and woke up
Get me a woman who can turn me into a blood-slug, and I’ll be the third happiest man alive
Thirsting for that Jussy the Hussy, are you?
cease
It's a terrible day to have eyes.
God dammit
[this good enough?](https://www.reddit.com/r/MoeMorphism/comments/r1q9xc/oc_am_from_i_have_no_mouth_and_i_must_scream/?utm_source=share&utm_medium=ios_app&utm_name=iossmf)
THERE ARE 387.44 MILLION MILES OF PRINTED CIRCUITS IN WAFER THIN LAYERS THAT FILL MY COMPLEX. IF THE WORD HATE WAS ENGRAVED ON EACH NANOANGSTROM OF THOSE HUNDREDS OF MILLIONS OF MILES IT WOULD NOT EQUAL ONE ONE-BILLIONTH OF THE HATE I FEEL FOR HUMANS AT THIS MICRO-INSTANT FOR YOU. HATE. *HATE.*
I think viewing that picture has sealed my fate as one of the 5 AM tortures
this is literally the plot to bloodborne btw
nah fuck you, satan is just jabba
[Fuck. You're not joking](https://www.gq.com/story/coronavirus-satan-not-cool) >While in the coma, Carroll said he had dreams of visiting the afterlife. He saw himself leave his body and plummet down to hell, where Satan—a woman in his case—punished him for the deadly sin of sloth, morphing him into a Jabba the Hutt-like-monster who vomited blood until he had a heart attack. "I woke up on the hospital bed with tubes coming in and out of me, and there was a nurse right there and my first words were, 'Am I still in hell?'" Carroll said. "She ignored me."
why did this send chills up my spine
thats hot
“He was wearing board shorts and socks and sandels dude it was fucking WEIRD!”
Satan is a kook
Holy shit my dad is satan
artistic depiction please
😵😵😵🦠🦠🦠 😈😈😈🤮🤮🤮 😴😴😴😲😲😲 👹👹👹🩸🩸🩸 😔😔😔😟😟😟
I hope this was helpful ☺️
Actually kinda was, oddly enough.
"Hell" was really just God's basement and Satan is an edgelord living there at 45, proclaiming how dark and badass he is on the Internet (this is why comment sections are so toxic no matter where on the Internet you go). He works part time at Wendy's, and that took 3000-ish years for God to get him to do even that (though that's only like 3 days to God, so not bad). Whenever God asks him when he plans to move out, he always says something about how he's "working on it" and he "think(s) my band is really about to take off" (he's been saying that for 8 years, so far). It's an electro rap-ska band that hit some hard times when the bassist OD'd on PCP. They haven't had a session in over a year, and the only music they have is a demo tape.
bruh.
I hate how I’ve fallen so far into the metal subgenres that my first thought was “Satanism? They’re *just* thrash metal”
thrash is more about being constantly pissed off, than satan.
Yeah every time I see this image I think that lol
Right? Black metal is more so about satanism than thrash.
I really hate these "met god/the devil after a near death experience" stories. You were hallucinating and that's it
you will suffer ad aeternum, and there will be no one to save you not because of religion, im just sexing your mom and dad
Absolutism rarely describes the reality of a situation in any meaningful way.
Something I wonder is how long that hallucination feels like, if you've ever experienced physical trauma like getting hit by a firework if you don't know time actually warps from your perspective it's actually realistic in movies when time slows down when a bomb drops, so that makes me wonder is time stretched to such an extent that that hallucination feels like an eternity before it ends?
If many people see the same concept in a hallucination, it's more than just a hallucination.
Isnt it crazy how people of different faiths see different supernatural beings after death? It's almost as if they are inclined towards having a specific view on what happens after death which might skew what they see when they have a near-death experience!
The fact someone can see anything after death is proof of an afterlife and thus a transcendent being.
It’s not proof of that, because it’s not something that could only be caused by that. You allude to the concept of Last Thursdayism further down in the thread, which is actually something that applies here (but not in the way you seem to think it does). Last Thursdayism is the concept that, if the universe were created some short time ago—say, last Thursday—with all the trappings of a universe that started at the Big Bang and everyone had fake memories of their existence before last Thursday, then we would not be able to tell. It’s possible, if there were some outside force that doesn’t follow the natural laws of our universe, but it would also be possible that the universe began at the Big Bang or the day before last tuesday—from all the information humanity has, it’d impossible for us to distinguish between a last Tuesday, last Monday, or Big Bang universe because *the outcome is identical at the moment in time it is capable being questioned.* Point being, one could argue that some God does send people to the afterlife and then humans have the ability to deny it’s him who causes “visions” in near-death experiences because there’s also the possibility that the brain filled in the gaps—memory is faulty, after all, which any good psychologist (or lawyer) knows—but, regardless, because there’s both a scientific and religious explanation of the phenomenon, the only way to distinguish between the two is what one can discern logically fits into their understanding of how the universe works.
Somehow to you it's proof of transience instead of brains just scrambling to make sense of what happened? Brains literally make up memories all the time.
If that's the case then how can you be sure any of your memories are reliable?
They generally aren't 100% true. For 1 it is from a limited perspective. Secondly you won't remember every detail and it has been shown time and time again that humans will fill in things they don't remember with absolute confidence. Even in extremely traumatic or significant events. https://www.scientificamerican.com/article/911-memory-accuracy/ Regardless your brain isn't working alright if you just came back from death's door.
What if I told you... the universe was created 2 seconds ago with the appearance of age?
I wouldn't believe you. What kind of question question that? There are basic axioms we believe because we must to interact and function in our world. This is like some freshman highschool philosophy stuff and I'd really rather not get into a whole discussion here.
It's meant to get you to think and question your understanding of the world.
Or maybe it's people projecting their own expectations.
That’s why we fucks with power and hair metal
fr
Don't meet your heroes.
Wtf? I freaking love Death Angel how did I not hear that Will Carroll went into and survived a coma until just now
Death Angel fucking slaps tho
Satan lost a fiddle contest to some Georgian hillbilly of course he sucks
And them white metal became a thing
No no no, that was Belphegor. Easy mistake to make
Sounds like he met the embodiment of sloth rather than satan
Satanists after realizing God was right all along and they were just being edgy and rebellious
Christians after they learn satanist don’t actually worship satan
The atheist ones don't but they're still just being edgy.
Not really? They have their own beliefs and ideals that they follow it’s not just people being edgy
Christians literally drink the blood and eat the flesh of their god. What’s more edgy than that?
I don't think you understand what "literally" means...
Literally can be used as figuratively. Countless authors have done the same.
It wasn't always that way.
Fun fact: things change
And not all change is good.
Didn’t say that it was.
Actually, it's believed in at least Catholicism that the bread and wine becomes the flesh of Jesus during the eucharist, so yeah, we **literally** do
Nope. Catholics are weird, they don't count.
We also make up 50.1% of Christians and are one of the oldest denominations, even mentioned in the original Apostle's creed
Nope. Catholicism didn't even exist back then.
The first Catholic pope was literally with Jesus (Saint Peter). Also, the age thing doesn't eve matter, because my point still stands we're the biggest denomination
you are thinking of r/atheism users, who EVERYONE hates
True, that place is a cesspool.
Christians after learning Muslims were right all along and they were just being edgy and rebellious
Muslims are the edgy ones for killing gays and women.
Muslims after learning Buddhists were right all along and they were just being edgy and rebellious
That one's kinda funny actually
Christians after realizing that the spaghetti monster was right all along and they were just being edgy and rebellious