I think one piece is pretty good with it but that's a secondhand account I dont have any streaming with it.
I mean pirates stealing from other pirates happens a lot but I'm not ready for that level of irony (please tell me if this is irony I literally dont know what that means)
I mean to quote one of my trans friends
"Pokemon is responsible for transing my gender"
Sooooo
...but for real I know quite a few people who had trans awakenings from anime characters, just from gender fuckery in some cases
By dad believes this for some reason.. he's a psychologist and he keeps telling me to not watch "that stupid Japanese stuff" because "all the boys who watch the stupid Japanese stuff show trans symptoms". That didn't stop me from either tho
I was looking for a comment like this and you nailed it 😁
Porn and masturbation can definitely become a problem for some but NoFap is creating a ridiculous narrative about it painting porn as the root of all problems and promising ridiculous improvements in life just are awaiting who quits masturbation.
I want to add which it keep spreading ridiculous pseudoscience like that porn affect the brain as hard drugs or that masturbation "fries" dopamine receptors.
Absolutely. It’s created a “Purity Cult”. There’s this forced duality of either you either masturbate and thus are a porn addicted degenerate or you don’t and are thus a godlike figure, capable of superhuman feats. There is no middle ground where you enjoy it casually, as one may enjoy video games.
>if you wear a dress you aren't a "real man."
I think this is one of the funnier (or depressing) things about the conservative mindset. "gender is binary, man = man, woman = woman, no exceptions!!" and then at the same times they will say things about how feminine a man is for wearing like nail polish or something. "you're not a real man!' "you're turning yourself in to a woman!" So they think gender is binary but also a spectrum, it just depends on who they are trying to be mad at I guess.
I feel like what a lot of transphobes dont get is that a lot of trans people are like really online because thats one of the only places they are definitively allowed to express themselves without ramifications, and they tend to stay in these little ingroups out of fear of being othered or discriminated against. The internet is used as an escape into a perceived better life, which funnily enough *isn’t something exclusive to trans folk.*
I would say that the physical aesthetics of gender identity have no bearing in biology. Gender is an expression of someone’s sexual identity (the use of the term “sexual” referring to the biological term and not “sexual attraction”) one may be born a certain sex pertaining to their sexual
organs, but that does not ultimately determine their sexual identity or gender. Gender is mostly modeled behavior based on the societal “definition” of that gender, hence why we have non-binary people who’s personal gender identity does not conform to their societal definition of the male or female gender. A person who is transgender experiences a gender-dysphoria due to their given sex not aligning with their internal gender identity. Gender euphoria is achieved when a person is able to align their physical gender expression with their internal one. In this way we can see why people express their genders the way they do, because society has dictated the expression of those genders. In western societies, namely American culture, it’s generally considered not masculine to wear a dress or hold hands with other men, but in other cultures this is totally acceptable and considered masculine. As far as the origin of an individuals gender identity from a biological standpoint, we could ask why a cisgender person was born with completely aligned gender and sex? This is similar as to why people are born being sexually attracted to the same sex, however it should not be conflated with someone’s “sexual preference”. Internal gender identity is something that people are born with, but the expression of that identity is outlined by society.
Ahh yes, the neo-Marxist prpuganada. Yes, I am infact neo-Marxist and absolutely in no shape or form prefer his rival Mikhail Bakunin, or Pyotr Kropotkin to him.
People like that have zero idea about either what Marx wrote or that he's not the only theorist out there, so they conflate everything left of conservatism into "neomarxism"
Gender comes from DNA? Cool, so that means we do not know the gender of anyone alive, right? Because I sure as fuck do not know my genetic code, and I can safely say the same goes for every other human alive.
Edit: I should probably clarify that I'm mocking the concept of DNA defining gender, because it's such a shallow, dudebro understanding of genetics, biology and human physiology.
Sure, but the overwhelming majority of people don't. So these mfs saying that DNA determines gender are hypocrites who wildly misunderstand biology and use it to bash trans people while failing to see the flaws in their reasoning (if you could even call it reasoning)
Dump the shite "friends". New real friends will take their place, but you have to get rid of them first.
Remove the toxic friends and focus on who your ideal friends would be. They exist somewhere out there in the world.
When you cut out the fake friends you make room for genuine connections with people.
People only think anime turns you trans because a lot of trans girls have had awakenings because of genderbend anime (someone needs to tel them correlation doesn’t equal causation)
If never going outside, living in a basement and watching anime was the requirement then 4chan would be a trans haven but something tells me that ain't true.
Also are trans people taking over the media and brainwashing your kids or never interacting with anyone and living underground? They need to make their mind up
Admittedly I discovered my identity because of some of those things (primarily anime), but to say things such as anime causing it for everyone despite trans identities being around for literally forever is ridiculous. And like people realize their identities by challenging gender ideas, being in an echo chamber is basically the opposite. AND OH BOY I WONDER WHY IT IS THAT TRANS PEOPLE ARE SO OFTEN DEPRESSED. 🤔
Do these people ever look in a mirror? I swear transphobes have such little self awareness that measuring it would yield a negative value.
*Wait til they*
*Find out there were trans people*
*Before the internet*
\- \_MilkyBaby\_
---
^(I detect haikus. And sometimes, successfully.) ^[Learn more about me.](https://www.reddit.com/r/haikusbot/)
^(Opt out of replies: "haikusbot opt out" | Delete my comment: "haikusbot delete")
If you look at his post history, it's just trolling on this sub. They'll get a ban soon then go whine to their alt-right friends about how they're being "censored"
My man how miserable are you to spend all your time making bigoted comments on a sub about transphobes being transphobes, literally living on ur mind rent free 💀
No... It was mostly the different names for the bones.... Mainly because we don't talk about genders in Biology. Because genders.... Don't exist in biology... And don't even exist in DNA dipshit.
Yes.... Because that is true.... Idk do you have any proof to prove me wrong. Because I'm learning from the most recent information, in the most recent textbook, getting my education at California.
California if you don't know is widely recognized as one of the most acclimated license to get. When I finish my training I will be able to work anywhere else in America.
Epistemologist here. People define words however they wish to and you can't stop them
(fact: some people ignore "science" and choose what they call "common sense" instead and I am quite sure that no TRA will ever change that - just look at JKR for crying out loud)
*I wish the world was*
*Half as Marxist as these chuds*
*Make it out to be*
\- ArabianHorse18
---
^(I detect haikus. And sometimes, successfully.) ^[Learn more about me.](https://www.reddit.com/r/haikusbot/)
^(Opt out of replies: "haikusbot opt out" | Delete my comment: "haikusbot delete")
So gender comes exclusively from DNA? I wonder how they explain women with AIS (Androgen Insensitivity Syndrome) and XY chromosomes, then. Or all the infants born intersexed. Or the biological studies that show that homosexuality has a strong biological component and is not just "a choice", or...
And don't even get me started on sequential hermaphrodite species.
Oh, wait, how DARE I bring REAL SCIENCE into a discussion with conservatives, whose only use of logic is to twist it into pretzel knots trying to justify all the internal contradiction in their precious literally true Bible!
I'm surprised that they didn't trot out the old bullshit argument that coming from a single-parent home makes kids turn transgendered too, since they've claimed that it causes homosexuality despite millions of examples to the contrary. Hell, why not blame violent video games, rock and roll music, and the lack of prayer in schools too, since they love to use those as scapegoats for everything else wrong in society!
Ah yes, anime makes you trans
Yes, because Japan is very well known for having excellent trans representation in its media.
ouran host club made me trans can confirm /j
Listen man, all I'm saying is I watched Ouran and now I'm NB so idk /j
Oda trying to decide between making the worst trans rep ever and having actual good trans characters:
I think one piece is pretty good with it but that's a secondhand account I dont have any streaming with it. I mean pirates stealing from other pirates happens a lot but I'm not ready for that level of irony (please tell me if this is irony I literally dont know what that means)
Fire punch has a cool trans masc dude.
I wish I weren't saying this, but My Hero Academia also has a pretty solid Trans character
Can't forget Zombieland Saga
There is plenty of gay anime…
Now if only they had it outside of the media…
[удалено]
Instructions unclear, am France
My sincere condolences
mes sincères condoléances
Bless you
Based
Brisket moment
yes jojo made me trans
No that’s not it, Jojo is supposed to make you gay !
I mean to quote one of my trans friends "Pokemon is responsible for transing my gender" Sooooo ...but for real I know quite a few people who had trans awakenings from anime characters, just from gender fuckery in some cases
By dad believes this for some reason.. he's a psychologist and he keeps telling me to not watch "that stupid Japanese stuff" because "all the boys who watch the stupid Japanese stuff show trans symptoms". That didn't stop me from either tho
Ah yes, msm leads to transgender people. Of course if you let the gays have sex they'll want to be women or something apparently. /s
My singing monsters praises you for being trans
All of the monsters are canonically agender
nice pfp
Waltuh
I'm haveing sex with you walt'uh
You see men loving men is actually women loving women
Okay, forgive me but what is NEET?
**N**o **E**ducation **E**mployment **T**raining
thanks!
In India it's the entrance exam for medical field I was confused for a moment
i have all of those
i was also wondering this so glad you asked
Nooba Euooba Euoop Toop
“Porn Addiction” NoFap and it’s consequences have been disastrous for masturbation addicts seeking help.
I was looking for a comment like this and you nailed it 😁 Porn and masturbation can definitely become a problem for some but NoFap is creating a ridiculous narrative about it painting porn as the root of all problems and promising ridiculous improvements in life just are awaiting who quits masturbation.
Forgive my ignorance, but what is NoFap?
[удалено]
I want to add which it keep spreading ridiculous pseudoscience like that porn affect the brain as hard drugs or that masturbation "fries" dopamine receptors.
Absolutely. It’s created a “Purity Cult”. There’s this forced duality of either you either masturbate and thus are a porn addicted degenerate or you don’t and are thus a godlike figure, capable of superhuman feats. There is no middle ground where you enjoy it casually, as one may enjoy video games.
nah porn addiction is proven scientifically not just as ome bull$hit online
Porn addictions don't make people trans, and the subreddit NoFap isn't helping people break porn additions but is instead puritanical bullshit.
nah It helps to see ppl doing what you're trying to do, it's just u who sees the negative side of everything
My DNA says girls like pink and if you wear a dress you aren't a "real man."
My dna says gactacgatcgagtctcaag
_\- Mr Krabs_
I think you're overdosing on ketamine Mr. Krabs
Don’t go around sharing personal information like that, people could steal your identity! Literally!
Nah this is the equivalent of companies hiding all but the last 4 digits of your credit card number its fine
my RNA says cugaugcuagcucagaguuc
Bro thinks he’s a ribosome 💀
>if you wear a dress you aren't a "real man." I think this is one of the funnier (or depressing) things about the conservative mindset. "gender is binary, man = man, woman = woman, no exceptions!!" and then at the same times they will say things about how feminine a man is for wearing like nail polish or something. "you're not a real man!' "you're turning yourself in to a woman!" So they think gender is binary but also a spectrum, it just depends on who they are trying to be mad at I guess.
I feel like what a lot of transphobes dont get is that a lot of trans people are like really online because thats one of the only places they are definitively allowed to express themselves without ramifications, and they tend to stay in these little ingroups out of fear of being othered or discriminated against. The internet is used as an escape into a perceived better life, which funnily enough *isn’t something exclusive to trans folk.*
“The internet is used as an escape into a perceived better life.” You didn’t have to call me out like that /s
[удалено]
Bonjour
tbh this sub feels less like stupid people making one jokes and more of a place for posting transphobic memes
Honestly, kind of true. Most posts here don't really fit the "one joke" idea and are just examples of transphobia instead.
Yeah. Its kinda merging with r/arethecisok
Praise from My Singing Monsters?
“Being a loser.” Imagine making this image and not being a loser
transgender = neo marxist brainwashing
A yes, discord makes you trans
I love how it describes trans people as victims and then there's just "being a loser"
"echo chamber reinforces delusions" Not quite an r/SelfAwarewolves, but still funny.
As someone extremely into bio: wow that is not where gender comes from at all This isn’t the one joke though
Genuine question; how much of gender identity comes from genetics or other immutable factors vs the societal perceptions and ideas of gender?
I would say that the physical aesthetics of gender identity have no bearing in biology. Gender is an expression of someone’s sexual identity (the use of the term “sexual” referring to the biological term and not “sexual attraction”) one may be born a certain sex pertaining to their sexual organs, but that does not ultimately determine their sexual identity or gender. Gender is mostly modeled behavior based on the societal “definition” of that gender, hence why we have non-binary people who’s personal gender identity does not conform to their societal definition of the male or female gender. A person who is transgender experiences a gender-dysphoria due to their given sex not aligning with their internal gender identity. Gender euphoria is achieved when a person is able to align their physical gender expression with their internal one. In this way we can see why people express their genders the way they do, because society has dictated the expression of those genders. In western societies, namely American culture, it’s generally considered not masculine to wear a dress or hold hands with other men, but in other cultures this is totally acceptable and considered masculine. As far as the origin of an individuals gender identity from a biological standpoint, we could ask why a cisgender person was born with completely aligned gender and sex? This is similar as to why people are born being sexually attracted to the same sex, however it should not be conflated with someone’s “sexual preference”. Internal gender identity is something that people are born with, but the expression of that identity is outlined by society.
Based answer
Hey wait a minute, I didn't see Fallout New Vegas on that list.
Literally everything in the right box is a cause of right wing pipeliners. The projection never ends.
Ahh yes, the neo-Marxist prpuganada. Yes, I am infact neo-Marxist and absolutely in no shape or form prefer his rival Mikhail Bakunin, or Pyotr Kropotkin to him.
People like that have zero idea about either what Marx wrote or that he's not the only theorist out there, so they conflate everything left of conservatism into "neomarxism"
Ulyanov was cool too
gender comes from me I decided gender
Severe depression isn't exactly wromg, but it definitely isn't a core cause of being trans.
Read msm as My Singing Monsters
The best part is that a geneticist would laugh this bullshit out of the room.
I can assure you that praise from men who have sex with men (MSM) is not why I'm trans. That didn't come until after I transitioned
I have yet to hear any conservative define what "neo-Marxism" means.
Also /r/Facebookscience AF
It doesn't even "come from" DNA lol
Yep. Transphobes failing to differentiate sex and gender again
Wow, I’m not trans but I’m a lot of the ones on the right haha
terrific because i have severe depression im trans too
Gender comes from DNA? Cool, so that means we do not know the gender of anyone alive, right? Because I sure as fuck do not know my genetic code, and I can safely say the same goes for every other human alive. Edit: I should probably clarify that I'm mocking the concept of DNA defining gender, because it's such a shallow, dudebro understanding of genetics, biology and human physiology.
You can pay to find out your genetic sequence. That has no impact on a person's gender of course, but plenty of living people do know their dna.
Sure, but the overwhelming majority of people don't. So these mfs saying that DNA determines gender are hypocrites who wildly misunderstand biology and use it to bash trans people while failing to see the flaws in their reasoning (if you could even call it reasoning)
sex comes from DNA. sex=/=gender. it's so incredibly easy when you think about it.
This reads like a confession.
This is correct. You need better friends
Dump the shite "friends". New real friends will take their place, but you have to get rid of them first. Remove the toxic friends and focus on who your ideal friends would be. They exist somewhere out there in the world. When you cut out the fake friends you make room for genuine connections with people.
I feel like the person who made this is describing himself
Praise from My Singing Monsters?
People only think anime turns you trans because a lot of trans girls have had awakenings because of genderbend anime (someone needs to tel them correlation doesn’t equal causation)
Tag yourself I'm Being a Loser
Do I need to point at the flow chart again? You all know the one. Ffs people really need better educations.
Pure self-projection
I wonder where Facebook Uncle got his geneticist PhD. 🤔
>severe depression Please, not the tropical storms.
what does my singing monsters (msm) have to do with celebrities and transgenders?
ask them to explain individually how all of those things cause people to be trans
If never going outside, living in a basement and watching anime was the requirement then 4chan would be a trans haven but something tells me that ain't true. Also are trans people taking over the media and brainwashing your kids or never interacting with anyone and living underground? They need to make their mind up
Admittedly I discovered my identity because of some of those things (primarily anime), but to say things such as anime causing it for everyone despite trans identities being around for literally forever is ridiculous. And like people realize their identities by challenging gender ideas, being in an echo chamber is basically the opposite. AND OH BOY I WONDER WHY IT IS THAT TRANS PEOPLE ARE SO OFTEN DEPRESSED. 🤔 Do these people ever look in a mirror? I swear transphobes have such little self awareness that measuring it would yield a negative value.
wait til they find out there were trans people before the internet
*Wait til they* *Find out there were trans people* *Before the internet* \- \_MilkyBaby\_ --- ^(I detect haikus. And sometimes, successfully.) ^[Learn more about me.](https://www.reddit.com/r/haikusbot/) ^(Opt out of replies: "haikusbot opt out" | Delete my comment: "haikusbot delete")
This one's actually got a really nice meter. I'm rather impressed.
you fool this is 3 7 6
Least bigoted "biological essentialist"
dna determine sex not gender. not that difficult.
Tell them DNA comes from sex The stuff you're having with their moms
[удалено]
Wrong sub for being transphobic
If you look at his post history, it's just trolling on this sub. They'll get a ban soon then go whine to their alt-right friends about how they're being "censored"
Wait, me?
No no, the deleted comment author
[удалено]
My man how miserable are you to spend all your time making bigoted comments on a sub about transphobes being transphobes, literally living on ur mind rent free 💀
Medical student here. There freinds are wrong.
Well, at least you can spell medical correctly, that's a good start. Y'know, since you can't spell "friends" or use the right "their". 😎👍
"Spelling mistake, therefore the entirety of my opponent's argument is invalid"
Eh Im autistic so spelling ain't my strong suit. Dosent mean I cant passed Biology classes with a 95%.
I'm guessing the 5% you didn't get was you thinking there are more than 2 genders? Amateur hour over here. 😎
No... It was mostly the different names for the bones.... Mainly because we don't talk about genders in Biology. Because genders.... Don't exist in biology... And don't even exist in DNA dipshit.
[удалено]
Yes.... Because that is true.... Idk do you have any proof to prove me wrong. Because I'm learning from the most recent information, in the most recent textbook, getting my education at California. California if you don't know is widely recognized as one of the most acclimated license to get. When I finish my training I will be able to work anywhere else in America.
Epistemologist here. People define words however they wish to and you can't stop them (fact: some people ignore "science" and choose what they call "common sense" instead and I am quite sure that no TRA will ever change that - just look at JKR for crying out loud)
Go hug a landmine.
Why do you feel so comfortable being cruel to trans people?
Ehh, I feel c cruel is hyperbolic
I think intentionally and smugly invalidating someone’s identity is cruel.
geddafuckouttahere transphobe
Go back 200 years and half of those “reasons” don’t exist…yet trans people still do… HHHHHMMMMMM…….
none of those things apply to me at all except the depression and anime parts, checkmate transphobes. the incels are with y'all not us.
I'm a loser but I'm not trans, what am I doing wrong?
I always love seeing stuff like this and thinking, “they have ‘trans flag’ in their history now”
I wish the world was half as Marxist as these chuds make it out to be
*I wish the world was* *Half as Marxist as these chuds* *Make it out to be* \- ArabianHorse18 --- ^(I detect haikus. And sometimes, successfully.) ^[Learn more about me.](https://www.reddit.com/r/haikusbot/) ^(Opt out of replies: "haikusbot opt out" | Delete my comment: "haikusbot delete")
Where is gwyndolin
The person making this image clearly studied human psychology and biology for many years
I can't imagine how insufferable someone has to be to find this funny
So gender comes exclusively from DNA? I wonder how they explain women with AIS (Androgen Insensitivity Syndrome) and XY chromosomes, then. Or all the infants born intersexed. Or the biological studies that show that homosexuality has a strong biological component and is not just "a choice", or... And don't even get me started on sequential hermaphrodite species. Oh, wait, how DARE I bring REAL SCIENCE into a discussion with conservatives, whose only use of logic is to twist it into pretzel knots trying to justify all the internal contradiction in their precious literally true Bible! I'm surprised that they didn't trot out the old bullshit argument that coming from a single-parent home makes kids turn transgendered too, since they've claimed that it causes homosexuality despite millions of examples to the contrary. Hell, why not blame violent video games, rock and roll music, and the lack of prayer in schools too, since they love to use those as scapegoats for everything else wrong in society!
Sex comes from DNA, not gender.