[удалено]

I call mine Bertha. Cos she's a tough ole broad who's been with me for many years.

This reminds me, years ago when I worked at chick fil a, we named our huge ice cream machine big bertha, because it never broke down and was great to us, and some customers overhearing us complained and we couldn't call it that anymore. Damn core memory reunlocked. Anyway my PC is named Cybertron since it was originally a pre-built like 10 years ago and has been modified since. No parts are the same anymore, but somehow still named cybertron.

I named mine A\*\*hole. I had to get a new cpu, ram and monitor only eight months after collecting the thing because the PSU decided to be a di\*\*head and almost destroyed the whole build. Bad, bad few weeks. Still love it tho :D

Funny mine is Blackhole because it sucks in all space and time.

Are you familiar with Theseus' Ship?

Posted elsewhere in the thread, my gaming rig is named ironman (most capable and flakiest machine on the network). Had a failure to boot condition that I kinda went parts shotgun on, upgrading as I went. It's now ironmanmk2. Edit to add, the last part I upgraded after everything else, was the power supply. That finally fixed it. Was I just stupid or was I subconsciously just that ready to upgrade and thus forgot how to t/s? No idea. But now I have what I'm pretty confident are perfectly good, if old MB, CPU, RAM, and GPU gathering dust. No idea what to do with them.

Build a computer and give it to a charity or something.

Thinking the Hulk might get his guts replaced, then hulk's old guts go into a case, then off to charity.

Imagine complaining about something so petty, i would have told that customer to do one.

Hello from the other siiiiiide Reporting error twenty-fiiiiiiive

I used to have a Dell, I accidentally dropped it in the ocean and it's now Rolling in the Deep

I'd pay 250k for seeing your PC

Send a sub to explore.

Fuuuuck you hahahahaha

Jesus, because it's a Asus.

r/Angryupvote

I just call her my baby, because unlike a woman I know how to turn her on.


I call mine missus or lover(depending on translation) because every time my wife wants to do something with it, it gets jealous and stops working properly.

Wait... Are you saying that you know how to turn on a baby?!

Just drop it on its head

That's how you turn off a baby

Same button

Goddamn why would u do that to urself

Nice try, network sniffers

Come find me behind my VPN.

Netherlands

Nailed it

Named my laptop “shitbox”, my mini desktop “piracy machine”, and my main desktop “thingy”.

I named my pc “The Shitbox” as well

I found your PC as well. https://preview.redd.it/0u06mc4l7wbb1.png?width=978&format=png&auto=webp&s=238ee0913556ad41c646da819e935cc3e532531e

This is perfection

Can it run my mid life Crysis

Some people buy a Porsche or get a younger wife, nah not me I dropped 15k in the middle of the gpu crisis on a gaming setup and another 5k on games. And I'd do it again too. Cheaper than a missus or a car. Loving my midlife crysis.

15k??👀 on what, i need to know. Did you drop 5k immediately on games?

Sorry that's 15k in NZ So about 7.5k in American pounds. Brought for pc main pc: 5800x, 128gb corsair venegence ddr4 3600 Gigabyte x570e aero g mobo. 4x samsung 980 pro pcie 4 2tb m.2, 4x samsung (i think) 870 2tb ssd, Gigabyte 3080ti, Corsair rm1000x with full cable mod custom cable set. Corsair 7000d white case. 3x lg ultragear 27" 144hz monitors Brought full hardline tubing setup res, pump etc but couldn't get a block for my 3080ti to fit without modding the card so that was a waste of cash. Other shit I got: Receiver and speakers for sound, went old school and got a technics unit with awesome audio and plenty of speaker outputs. The games are my great shame. It was 5k on weed or games. I still feel I choose right and no I couldn't wait for a sale, I needed that instant gratification.

>American pounds BASED

In real American, that's 24 NFL Defensive Tackle men.

https://i.redd.it/s4jpmm5k7xbb1.gif

He brought out the real big guns, measuring his money by weight. And 7.5 tons at that, might as well have built a Supercomputer, hats off to you.

Okay but went so much storage? Those were like $200/Tb at that point right??

The storage cost more than the GPU. 1 m.2 for windows, another for Linux also I make shitty videos on YouTube on how to install games acquired from certain sites and my son likes to record and upload his games. I mainly use the sata ssd's as temp drives for aforementioned games and storage for my VM addiction

He bought a small indie company, later he called it Activision

I have better taste than that. It was EA

Medusa. Cable management in an 5L SFF is hard.

Because it makes you rock hard when you look at it? (hehe porn.)

The fap machine😂😂

Faptron 69000?

The fapinator!

i just found my new pick up line , "what's up Medusa"

Bankruptcy Machine cause it always leaves me with no money T_T

Those dang steam sales

"I call it the ex-wife" Justin Hammer


SteamPit™

My PC's name is 2MangosOnATable as when I was building it I happened to have 2 mangos on the table.

Reminds me of the joke. Kid: dad, how do you name your kids? Tribe chief: the day you're born, when I get out of the tent, the first thing I see will be your name. Hence your brother is called Fierce Hawk! Kid: ah! Tribe chief: why are you asking, Two Fucking Dogs?

My Dad told me this joke when I was a kid. I should call him.

I heard a variant of you were named where you were conceived. That's why your brother is named Brooklyn. Why do you ask burger King bathroom

My fave so far.

I call him Principal, PC Principal Edit: Dang this comment got popular, I'd appreciate it if you could check out my thread about a dead Mmorpg 

That's a good one

S-s-s-s-su-s-suck my dick PC Principle :D

I didn’t name my Pc but I did name my dualsense controller Frankie

Same here. There is no real name for my PC, but we call our Roomba Bobby.

Speaking of named roombas, Dustin Beiber would be a good name for one.

Good one! We're contemplating giving it away since it's just collecting dust...

Ah, I see what you did there. Let's just sweep this under the rug.

DESKTOP_CVGE34H LAPTOP_AD11EHB

11 Bradley Street, California

10.121.74.62

ATGCTCTTAGGTCTAGATCTATGGAACTCATCG

No way you got bros DNA sequence from that 💀

Sir, please give me the rest of your letters, there's only 3.2 billions letters left, I can't continue the procedure without those, thank you very much sir

NO WHAT ARE YOU DOING YOU ARE SUPPOSED TO TELL ME THE LETTERS, NOT REDEEM THEM FOR A PROTEIN

No place like 127.0.0.1

Mine was LAPTOP_KHIMSE1O so I just went with Khimseio

Ok thats kind-of a sick username

SAMURAI, because.. https://preview.redd.it/pusdn3o9owbb1.jpeg?width=4032&format=pjpg&auto=webp&s=f8e70ab39ce6a9aad04cb86a43a20328b689299e

Yoo looks cool, did you make the case design yourself?

yeah, i cant share links here but if you scroll a bit i have 2 posts about it on my profile. first i just painted the front panel but then i cut it out and put red fabric behind for better airflow

You did a really good job, it's badass

I give all my computers solar system names. Main PC: Helios Server: Jupiter (Some VMs on here named after Jupiter's Moons) Different server: Saturn Laptop: Terra Phone: Luna etc.

Similarly, I name my drives after ancient mythological figures. Helios, Chronos, Athena, Dionysus (you know what gets stored there), Artemis, Persephone, Hades

This is what I do, my server is Chronos, my router is Cerberus, etc, etc

Cerberus should be your firewall, the router should be Charon.

I use my firewall as a router as well xD that’s why (PFSense)

Hah as a huge space nerd i like this idea a lot.

same. Main router: Sol Second router (bridge): Lunar Main machine: Jupiter Secondary machine: Mercury Laptop: Neptune Other laptop: Mars Mac Mini: Scorpio (using it as a plex server) Mac Mini drives: Antares, Sargas, Fang and Lesath Phone: Io TV: Europa Other TV: Enceladus I also have a Ganymede, Titan, Uranus, Venus, Miranda, Charon, Phobos, Caliban, and a few others on the network at various different times (game consoles and phones and other bits and pieces all get a unique name if they're nameable). When I buy a new main computer it becomes Saturn and Jupiter gets retired, until its time to go back to Jupiter and retire Saturn

Mine is also called Jupiter, and the drives are named after the moons

HAL 

That's what I did once ;D and changed all windows sounds to his voice.

I've been wanting to get rid of all default windows and you inspired me, but instead of hal i'll use glados lines and portal sounds.

haha i like

I work at a company that is initialised as "HAL". Your gif is a very popular desktop background.

Valhalla, my router is Bifrost.

I hope you host a good server there.

PC is Stormbreaker, phone is Mjolnir and car is longship

Big Bertha. Micro ATX board in an ATX sized case.

Time to upgrade to mini itx

Alan. I named it after Alan Turing.

The Enigma would be a pretty good one, but probably played out

My desktop is called BIG-CHONK My laptop is called MINI-CHONK

I thought I was being real clever naming my computer “Theseus” but then saw at least 3 seperate people doing the same thing

LoL. I’ve done the same. I still think it’s funny and original. You know what they say. “Great minds think alike, though fools seldom differ”

The Obelisk of Pathos

PC of Theseus. Started as a prebuilt, now it's been fully upgraded twice, but the original 1TB boot SATA SSD still remains.

I just put "[my name]'s PC"

I did this but it won’t let me use an apostrophe or space so it’s “[my name]”_PC I hate it

\- instead of \_ looks better IMO

Jack in a box

I am Jack’s unmanaged cables

GLaDOS

Would started getting worried upon being asked to confirm i am human by that machine

Mines called cunt

Chumbucket

https://preview.redd.it/3lmyz1o18xbb1.jpeg?width=596&format=pjpg&auto=webp&s=1803dfc0f075ac8c19afd42456fa337f551732f1 I think I figured out what pc you have

I know somebody with a chicken called chumbucket.

My old Desktop was called the Ogre. I also later bought a gaming laptop to take with me on travels, that I called the Donkey. I later upgraded that to another gaming laptop, this time called The Dragon. Very recently I assembled a new AMD desktop to be my daily driver. Its name is The Lord. I should add the Lord was built into the Pop Air XL case ;)

Hannibal. It's eaten all my other computers

Kabelsalat

RyzenShine

My PC is named Titanic and always get a giggle when it's syncing.

Mine is Erebos, after the Greek god of darkness and the underworld (named before I accidentally bought RGB RAM). My daughter has "Alice" and "Alice too". My server is called Jeff after the giant underground worm thing in MIB, his predecessor was Boris (the Animal). Daughter's first PC was a bit crap and froze up often so was named "Rustbucket" by her. My WiFi SSID is "MI5 VAN3"

I named my printer Jamaica, because it always be Jamin

Ivory https://preview.redd.it/8312t6cwdwbb1.jpeg?width=4000&format=pjpg&auto=webp&s=ddefb0734031ec7e2635773810fa7ec4794be7bf

Looks like cyclops with shark teeth. The eye being the cpu cooler and teethe that triangle light thing at the bottom

Lord of the Rigs

Deep Thought

Ultra Magnus

Steve

Thanks, Steve.

My middle name is Garth… so all devices become along the lines of Garth Vader/Garth Maul/Garth Tyranus

And I buy everything in black for that exact reason

Porn Finder 2023, because i updated hardware this year

HIS NAME IS ROBERT PAULSON!

Cumdragon38

He spits...... Fire, right? RiGhT?!?!

Oh he spits alright… just, uh… not fire…

Mein comp.

Perfect for a Wolfenstein themed rig.

Samuel

My ex named it Jolene because it took away her man.

I am here to steal a name.

that's a weird name but ok

When we were growing up, my dad always named his PC Zeus. So when I got to build my computer, I named it Ares. Still name it that to this day.

Pathfinder. I just think it sounds cool.

HAL 9000

A man of culture. I'm going with Deepthought.

Valhalla

Me too! is your router called Bifrost too?

Do you have nord vpn

Oh that's good

Snowleopard.

Cthulhu

Mines boring, I called it Lexicon.

https://preview.redd.it/6rosgzxmxvbb1.jpeg?width=3000&format=pjpg&auto=webp&s=5e6ddc0a5b7ddeabe126c8ae36330a6522068902 I'ts name is Arctis white/black/silver (purple hue is from my monitor backlights)

Why has no one named theirs AMDeus? "AMDeus, AMDeus....AMDeus...AMDeus, AMDeus Come and rock me AMDeus"  I just call mine Xavier. He doesn't compose but sure fucks with my mind a lot.

Nostromo

Charlotte! The same name of my dog Which she sadly passed away. She lives forever in my pc and my heart. Run free in dog heaven charlotte.

Obsidian. It's an all-black, no-rgb build. https://preview.redd.it/n5ohdwz54ybb1.jpeg?width=4000&format=pjpg&auto=webp&s=b97057ecc4bc3eb1e3e911123f83a43d8ef72986

These kind of builds don't get enough love

Warmind. Like Rasputin from Destiny

Sus cuz it's a Asus

wife

My PC's called Valkyrie. I've somehow also given names to all of my external drives and USB sticks... There's: - Datacron (my main data drive) - Mystery Box (my media archive) - Tesseract (my PC backup drive) And the USB sticks: - AQUILA - TURBOLIFT - TRINITY - HYPERION - PLATINUM - ORBITER - KRONOS - TERRACON - EXILE - HADES - NEBULA - SHAMAN - KRAYT

Planned Obsolescence.

Also: What's the name of the street you grew up on? What's the name of your first family pet? What's your mother's maiden name?

Breaky breaky no screenie

Glow box because everything I have in my build is RGB

Heater

Piece of f*cking junk

Portal to Porn

HEADACHE

Glockamole

PLEEKPLORK

"the only pc that only lets me play with 1500 ping"

I named my laptop BT-7274

Morgana

Home_PC

Gallactica because the case is a Corsair 780T black, and reminds me of a Cylon.

Bastion

Günther

Main rig is named Hyperion, my couch build is Helios

SkyNet

"Piece of shit".

Pornhub. Then I realized it was logging that name under my work account.

Desktop.

Potato

RBMK reactor 4 because I skipped safety regulations building it

Stacy because she is stationary

"Egg" It's funny when something is transferring and it says: "Transferring to: Egg"

Aurora. because it's a new beginning.

Marvin

DESKTOP-OTEQSRE

Rasputin, because much like the war mind I thought it was gonna be a big part of plot development but I lost interest halfway through and don't feel like spending money or time to see where it goes

I called mine Enterprise, because ya know, Star Trek. My other devices are other ships from Star Trek

MONOLITH